|
'''Shotgun sequencing''' is a method used in [[genetics]] for [[sequencing]] long [[DNA]] strands. Since the chain termination method of [[DNA sequencing]] can only be used for fairly short strands, it is necessary to divide longer sequences up and then ''assemble'' the results to give the overall sequence. In [[chromosome walking]], this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex process to assemble random pieces of the sequence.
{| class="eaf-infobox" style="border: 1px inset #f9f9f9; background-color: #e5e5e5; color: inherit; float: right; margin-left: 1em; width: 200px;"
| colspan=2 style="margin:0em; padding:0em;" |
[[Image:Barkley_370.jpg|350px|"Sir Charles"]]
|-
| style="border: 1px outset #f9f9f9; background-color: #e9e9e9; font-weight: bold; text-align: right; width:35%;" | Position:
| style="border: 1px outset #e9e9e9; background-color: #f9f9f9;" | Power Forward
|-
| style="border: 1px outset #f9f9f9; background-color: #e9e9e9; font-weight: bold; text-align: right; width:35%;" | College:
| style="border: 1px outset #e9e9e9; background-color: #f9f9f9;" | Auburn
|-
| style="border: 1px outset #f9f9f9; background-color: #e9e9e9; font-weight: bold; text-align: right; width:35%;" | NBA draft:
| style="border: 1px outset #e9e9e9; background-color: #f9f9f9;" | 1984, 1st <br>5th overall,<br>Philadelphia 76ers
|-
| style="border: 1px outset #f9f9f9; background-color: #e9e9e9; font-weight: bold; text-align: right; width:35%;" | Pro career:
| style="border: 1px outset #e9e9e9; background-color: #f9f9f9;" | 15 seasons
|-
| style="border: 1px outset #f9f9f9; background-color: #e9e9e9; font-weight: bold; text-align: right; width:35%;" | Hall of Fame:
| style="border: 1px outset #e9e9e9; background-color: #f9f9f9;" | TBD<hr>
|}
In shotgun sequencing, DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain ''reads''. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a contiguous sequence.
'''Charles Wade Barkley''' (born [[February 20]], [[1963]] in [[Leeds, Alabama]]) is a former [[United States|American]] [[basketball]] [[Power forward (basketball)|power forward]]. A current resident of [[Arizona]], Barkley is commonly nicknamed ''Sir Charles'' and occasionally ''The Round Mound of Rebound''. Barkley was named Most Valuable Player of the [[NBA]] in 1993. In 1996, the NBA's 50th anniversary, he was named one of the [http://www.nba.com/history/players/50greatest.html 50 Greatest Players in NBA History]. Barkley won the Olympic gold medal with the US Dream Teams in the 1992 and 1996 Games.
For example, consider the following two rounds of shotgun reads:
Barkley is best remembered for his tenacity and ruggedness for [[rebound (basketball)|rebounds]], despite his relative lack of height. Besides being one of the best rebounders ever, he was also a prolific scorer and a consummate team player. He had high career totals in scoring, rebounding, and assists, too. He is also famous for his behavior and often controversial statements off the court.
Original strand : AGCATGCTGCAGTCATGCTTAGGCTA
==Career==
Barkley played [[college basketball]] for [[Auburn University]], for three years where he excelled as a player, being named All-SEC and leading the league in rebounding each year. He mainly played [[center (basketball)|center]] at Auburn, despite being far shorter than normal for the position; he stands slightly under 6 ft 5 in (1.96 m). In [[1984]], he left Auburn a year early to begin playing in the [[National Basketball Association|NBA]] with the [[Philadelphia 76ers]]. Early in his career, Barkley had a weight problem, sometimes weighing over 300 pounds (136 kg) at Auburn. His nickname of "The Round Mound of Rebound" dates back to his Auburn days. He battled those problems, however, and was able to fill the spot left by [[Julius Erving]] on the team. Later teaming with power forward/center [[Rick Mahorn]], the two coined the nickname "Thump and Bump", the Sixers made the Eastern Conference Finals but lost to the [[Chicago Bulls]]. The team reached the playoffs with Barkley every year except for [[1988]], and [[1992]], when he was traded to the [[Phoenix Suns]]. While with the Sixers, Barkley was a force underneath the glass, and his aggressiveness often times got him into fights with players such as [[Patrick Ewing]], [[Shaquille O'Neal]], and [[Charles Oakley]].
First round of shotgun reads : AGCATGCTGCAG
In between being drafted and traded, Barkley became a household name, and he was one of a few NBA players to have a figure published by [[Kenner]]'s [[Starting Lineup]] toy line and also have his own signature shoe line by [[Nike, Inc]]. But he also became involved in a few scandals, notoriously a fight with [[Detroit Pistons]] center [[Bill Laimbeer]] in [[1990]]. He averaged 24.3 points per game while with the 76ers.
TCATGCTTAGGCTA
Second round of shotgun reads : TTAGGCTA
After joining [[Larry Bird]], [[Magic Johnson]] and friend [[Michael Jordan]] for the [[1992]] [[United States|US]] [[Dream Team (basketball)|Dream Team]] that won the gold medal at the [[1992 Summer Olympics|Barcelona Olympics]], Barkley went to the Suns, where he became a vital part of the team's trip to the [[1993]] NBA Finals, scoring 25 points per game and becoming one of the most popular players ever among Suns fans. At the Finals, Barkley and the Suns lost to [[Michael Jordan]], [[Scottie Pippen]], and the [[Chicago Bulls]] in six games, after Barkley had told Jordan that it was ''destiny'' for the Suns to win the championship. Barkley would never again return to the Finals.
AGCATGCTGCAGTCATGC
In this extremely simplified example, the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally aggravated by the great abundance of [[Repeated sequence (DNA)|repetitive sequence]], meaning similar short reads could come from completely different parts of the sequence.
In [[1994]], Barkley again was part of a Suns team that almost won the NBA championship, losing in the Western semi-finals in 7 games to eventual NBA champions the [[Houston Rockets]]. In [[1995]], the Suns suffered exactly the same fate in the playoffs as the year before. In [[1996]], Barkley and the Suns struggled to a 41-41 record, having to win 13 games in a row at the end to squeeze out a playoff spot. He also was a member of the gold medal winning American team at the [[1996 Summer Olympics]] in [[Atlanta, Georgia]].
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the [[Human Genome Project]], most of the human genome was sequenced at 12X or greater ''coverage''; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the ([[Euchromatin|euchromatic]]) human genome.
Barkley was then traded to the [[Houston Rockets]], where he joined [[Hakeem Olajuwon]] and [[Clyde Drexler]] in their quest to win championships. However, Olajuwon had already won two (1994, 1995), and Drexler one in 1995, which led people to believe that Barkley was the one who was really trying. But as a member of the Rockets, Barkley faced back injury problems, which ultimately led to his retirement in [[2000]]. His last year in the NBA, he averaged 14 points a game over 19 games before tearing his left [[quadriceps]] [[tendon]] completely away from his kneecap during a game on [[December 8]], [[1999]]. He was told by doctors that he would never play again in the NBA, but was able to come back a little over four months later, for exactly one game, scoring a basket in front of Houston's home fans on [[April 19]], [[2000]] against the [[Vancouver Grizzlies]]. Barkley retired immediately after that game.
==Whole genome shotgun sequencing==
During his career in the NBA, Barkey totalled 23,757 points for an average of 23 points per game, and 12,546 rebounds, for an average of 11.7 rebounds per game. He was an All-Star nine times, and he helped his teams to the playoffs every year he played.
Whole genome shotgun sequencing is an application of pairwise end sequencing, known colloquially as ''double-barrel shotgun sequencing''. As sequencing projects began to take on longer and more complicated projects, multiple groups began to realize that useful information could be obtained by sequencing both ends of a fragment of DNA. Although sequencing both ends of the same fragment and keeping track of the paired data was more cumbersome than sequencing a single end of two distinct fragments, the knowledge that the two sequences were oriented in opposite directions and were about the length of a fragment apart from each other was valuable in reconstructing the sequence of the original target fragment. The first published description of the use of paired ends was by Edwards et al. in 1990 as part of the sequencing of the human [[Hypoxanthine-guanine phosphoribosyltransferase]] locus, although the use of paired ends was limited to closing gaps after the application of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end sequencing strategy, assuming fragments of constant length, was by Edwards and Caskey in 1991. At the time, there was community consensus that the optimal fragment length for pairwise end sequencing would be three times the sequence read length. In 1995 Roach et al. introduced the innovation of using fragments of varying sizes, and demonstrated that a pure pairwise end-sequencing strategy would be possible on large targets. The strategy was subsequently adopted by [[The Institute for Genomic Research]] (TIGR) to sequence the genome of the bacterium ''Haemophilus influenzae'' in 1995, and then by [[Celera Genomics]] to sequence the fruit fly genome in 2000, and subsequently the human genome.
To apply the strategy, high-molecular-weight DNA is sheared into random fragments, size-selected (usually 2, 10, 50, and 150 kb), and [[clone (genetics)|clone]]d into an appropriate vector. The clones are then sequenced from both ends using the [[chain termination method]] yielding two short sequences. Each sequence is called an ''end-read'' or ''read'' and two reads from the same clone are referred to as ''mate pairs''. Since the chain termination method usually can only produce reads between 500 and 1000 bases long, in all but the smallest clones, mate pairs will rarely overlap.
Barkley ranked '''#19''' in [[SLAM Magazine]]'s Top 75 NBA Players of all time in [[2003]].
The original sequence is reconstructed from the reads using sequence assembly [[software]]. First, overlapping reads are collected into longer composite sequences known as ''contigs''. Contigs can be linked together into ''scaffolds'' by following connections between mate pairs. The distance between contigs can be inferred from the mate pair positions if the library size is known and has a narrow window of deviation.
==Additional info==
During his stint as a member of the Suns, Barkley was controversial and outspoken. He was rumored to have dated [[Madonna (entertainer)|Madonna]], and he became a favorite of late-night [[Television|TV]] talk shows. He published a pair of equally controversial books, and he was rumored to plan to run for Governor of Alabama. He was in the middle of many lawsuits. And, to top it all, he and Suns owner [[Jerry Colangelo]] became involved in a very public dispute during his last year as a Sun.
'''Coverage''' is the average number of reads representing a given [[nucleotide]] in the reconstructed sequence. It can be calculated from the length of the original genome (G), the number of reads(N), and the average read length(L) as <math>{NL \over G}</math>. For example, a hypothetical genome with 2,000 base pairs reconstructed from 8 reads with an average length of 500 nucleotides will have 2x coverage.
Later on, Barkley and Colangelo have seemingly cleared up their differences. On [[March 20]], [[2004]], in a game against the [[Milwaukee Bucks]], Barkley's number 34 jersey was retired by the Suns, as he joined [[Connie Hawkins]], [[Tom Chambers]]. and [[Kevin Johnson]] in the ''Suns Ring of Honor''.
Proponents of this approach argue that it is possible to sequence the whole [[genome]] at once using large arrays of sequencers, which makes the whole process much more efficient than more traditional approaches. Detractors argue that although the technique quickly sequences large regions of DNA, its ability to correctly link these regions is suspect, particularly for genomes with repeating regions. As [[sequence assembly]] programs become more sophisticated and computing power becomes cheaper, it may be possible to overcome this limitation{{Fact|date=February 2007}}.
One of the most infamous cases involving Barkley in a lawsuit was one where, according to an [[Orlando, Florida|Orlando]] man, he threw the man through a glass window during an altercation at an Orlando restaurant. Tired of people's accusations, Barkley, who is accessible to the public for [[Autograph|autographs]] and hand-shaking most of the time, limited his accessibility to the public to not much more than that. When asked if he had any regrets about throwing the man through the window, Barkley said "I regret we weren't on a higher floor."
==References==
Barkley now broadcasts games for [[Turner Network Television|TNT]] and plays at celebrity [[Golf|golf]] tournaments.
*{{cite web | title=Shotgun sequencing comes of age | work=The Scientist | url=http://www.the-scientist.com/news/20021231/06 | accessdate=December 31 | accessyear=2002}}
*{{cite web | title=Shotgun sequencing finds nanoorganisms - Probe of acid mine drainage turns up unsuspected virus-sized Archaea
| work=SpaceRef.com| url=http://www.spaceref.com/news/viewpr.rss.html?pid=21532
| accessdate=December 23 | accessyear=2006}}
*{{cite journal
Charles Barkley also made several appearances in the short-lived series [[Clerks:_The_Animated_Series|Clerks]].
| last = Anderson
| first = S
| coauthors =
| title = Shotgun DNA sequencing using cloned DNase I-generated fragments
| journal = Nucleic Acids Research
| volume = 9
| issue = 13
| pages = 3015-27
| date = 1981 }}
*{{cite journal
He also went one-on-one with [[Godzilla]] in the [[Nike, Inc.|Nike]] commercial (and a tie-in comic published by [[Dark Horse Comics]]).
| last = Fleischmann
| first = RD
| coauthors = et al.
| title = Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
| journal = Science
| volume = 269
| issue = 5223
| pages = 496-512
| date = 1995 }}
*{{cite journal
During the [[1991]]-[[1992]] season, his last in Philadelphia, Barkley wore number 32 instead of 34 in honor of [[Magic Johnson]], who had announced prior to the start of the season that he was [[HIV]]-positive. The 76ers had retired the number 32 in honor of [[Billy Cunningham]], who un-retired it for Barkley to wear. Also, in a very un-Charles like behavior, he rebuked himself for having made fun of people for having HIV (This was due to Magic, one of Charles' best friends, having HIV).
| last = Adams
| first = MD
| coauthors = et al. | title = The genome sequence of Drosophila melanogaster
| journal = Science
| volume = 287
| issue = 5461
| pages = 2185-95
| date = 2000 }}
*{{cite journal
On Magic Johnson's return to basketball: "We're just playing basketball. It's not like we're going out to have unprotected [[sex]] with Magic."
| last = Edwards
| first = A
| coauthors = Voss, H.; Rice, P.; Civitello, A.; Stegemann, J.; Schwager, C.; Zimmerman, J.; Erfle, H.; Caskey, T.; Ansorge, W.
| title = Automated DNA sequencing of the human HPRT locus
| journal = Genomics
| volume = 6
| pages = 593-608
| date = 1990 }}
*{{cite journal
He appeared alongside Michael Jordan in the hit movie ''[[Space Jam]]''. He also had a tiny cameo in the movie ''[[Hot Shots!]]''
| last = Edwards
| first = A
| coauthors = Caskey, T
| title = Closure strategies for random DNA sequencing
| journal = Methods: A Companion to Methods in Enzymology
| volume = 3
| issue = 1
| pages = 41-47
| date = 1991 }}
*{{cite journal
==Political aspirations?==
| last = Roach
Barkley has long held outspoken [[libertarian]] political views and has hinted at a possible run for [[Governor of Alabama]]. Rumors swirled that he was Republican. However, he rejected that rumor soon after he found out about it. He has repeatedly denied that he was a [[Republican Party (United States)|Republican]] in different TV interviews, and stated that he would run as an Independent. "I voted for [[John Kerry]], and I was disappointed that he lost." ([[Tim Russert]], 4/16/2005)
| first = JC
| coauthors = Boysen, C; Wang, K; Hood, L
| title = Pairwise end sequencing: a unified approach to genomic mapping and sequencing
| journal = Genomics
| volume = 26
| pages = 345-353
| date = 1995 }}
{{NCBI-handbook}}
He also endorsed Sen. [[John Edwards]] in his presidential bid in [[U.S. Democratic Party presidential nomination, 2004]].
[[Category:Molecular biology]]
== See also ==
* [[List of National Basketball Association players]]
* [[NBA Jam]]
[[ja:ショットガン・シークエンシング法]]
== External links ==
[[zh:散弹法]]
*[http://www.clintcam.com/barkley/ A collection of quotes of or relating to Charles Barkley]
{{wikiquote}}
{{Footer 1992 Olympic Champions Basketball Men}}
{{Footer 1996 Olympic Champions Basketball Men}}
{{NBA50}}
[[Category:1963 births|Barkley, Charles]]
[[Category:African American basketball players|Barkley, Charles]]
[[Category:Auburn University athletics|Barkley, Charles]]
[[Category:Houston Rockets players|Barkley, Charles]]
[[Category:Living people|Barkley, Charles]]
[[Category:National Basketball Association broadcasters|Barkley, Charles]]
[[Category:Olympic competitors for the United States|Barkley, Charles]]
[[Category:People from Birmingham, Alabama|Barkley, Charles]]
[[Category:Philadelphia 76ers players|Barkley, Charles]]
[[Category:Phoenix Suns players|Barkley, Charles]]
[[de:Charles Barkley]]
[[fi:Charles Barkley]]
[[fr:Charles Barkley]]
[[it:Charles Barkley]]
[[pl:Charles Barkley]]
| 