|
'''Shotgun sequencing''' is a method used in [[genetics]] for [[sequencing]] long [[DNA]] strands. Since the chain termination method of [[DNA sequencing]] can only be used for fairly short strands, it is necessary to divide longer sequences up and then ''assemble'' the results to give the overall sequence. In [[chromosome walking]], this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex process to assemble random pieces of the sequence.
'''Manhattan Beach''' is a city located in southwestern [[Los Angeles County, California]], USA. As of the [[2000]] census, the city had a total population of 33,852. Of a rotating City Council of five members, Joyce Fahey is the current mayor.
[[Image:Manhattanbeachpier.jpg|thumb|right|350px|The municipal pier in downtown Manhattan Beach.]]
The city is on the [[Pacific Ocean]] coast, to the south of [[El Segundo, California|El Segundo]], and to the north of [[Hermosa Beach, California|Hermosa Beach]]. To the east are the cities of [[Lawndale, California|Lawndale]] and [[Redondo Beach, California|Redondo Beach]]. It is one of the three [[Beach Cities]] in the [[South Bay, Los Angeles|South Bay]].
In shotgun sequencing, DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain ''reads''. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a contiguous sequence.
==History==
For example, consider the following two rounds of shotgun reads:
===Early inhabitants and european discovery===
The first known inhabitants of present day Manhattan Beach were the Engnovangas rancheria indians. The indians survived off of corbina fish they hunted in the shallows, along with other species of surf fish. The Engnovangas often made the 3 mile trek south to the salt flats in present day Redondo Beach, CA to harvest the mineral. The old Salt Flat is now occupied by Southern California Edison, roughly located on Herondo Street and North Harbor Drive. The salty estuary was said to be only 150 yards from the ocean and the rough size of 120,000 square yards.
Original strand : AGCATGCTGCAGTCATGCTTAGGCTA
In 1781, when El Pueblo de Nuestra Señora la Reina de los Angeles was established, a small, one-lane dirt road was cleared to connect the Salt Flat and Los Angeles. Aviation Boulevard now runs almost directly on top of the old Salt Flat road. Three years later, in 1784, the Spanish government established "ranchos", or land parcels, all along the South Bay. The land grants did not convey titles to the land; rather they simply gave permission to migrant farmers to use the land as they wished. In 1822, the newly-established Mexican government sold the land to the highest bidder. Some of the Ranchos purchased by farmers were: Aguaje de la Centinela, La Ballona, La Tijera, and Sausal Redondo, which translates into "round clump of willows." (Note that many streets in the South Bay region are named after these ranchos.) In 1822, Rancho Sausal Redondo (present day Manhattan Beach) was purchased by Antonio Ygnacio Avila, who mainly used the 22,500 acres for sheep grazing.
First round of shotgun reads : AGCATGCTGCAG
===Early development===
TCATGCTTAGGCTA
In 1863 a Scottish immigrant, Sir Robert Burnett, purchased Rancho Sausal Redondo and Rancho Aguaje De Centinela from Avila's heirs for $33,000. Ten years later in 1873, Burnett decided to leave the California sunshine and head back for Scotland. He found Canadian Daniel Freeman to watch over the ranch and they agreed to a lease for the ranch. Freeman moved his wife and three children onto the ranch and started producing various crops. On May 4th, 1885 Freeman
bought the ranch from Burnett for $140,000.
Second round of shotgun reads : TTAGGCTA
== Geography ==
AGCATGCTGCAGTCATGC
[[Image:PICT0144.JPG|thumb|250 px|right|The large, sandy beach in Manhattan Beach, as seen facing south, with the pier and the [[Palos Verdes Peninsula]] in the background.]]
Manhattan Beach is located at 33°53'20" North, 118°24'19" West (33.888980, -118.405357){{GR|1}}.
In this extremely simplified example, the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally aggravated by the great abundance of [[Repeated sequence (DNA)|repetitive sequence]], meaning similar short reads could come from completely different parts of the sequence.
According to the [[United States Census Bureau]], the city has a total area of 26.8 [[square kilometre|km²]] (10.4 [[square mile|mi²]]). 10.2 km² (3.9 mi²) of it is land and 16.7 km² (6.4 mi²) of it is water. The total area is 62.07% water.
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the [[Human Genome Project]], most of the human genome was sequenced at 12X or greater ''coverage''; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the ([[Euchromatin|euchromatic]]) human genome.
Manhattan Beach features 2.1 miles (3.4 km) of ocean frontage, 40 acres (162,000 m²) of recreational beach, and a total of 59 acres (239,000 m²) of parkland in 10 parks, 1 municipal golf course, and 1 parkway, the Valley/Ardmore "Greenbelt" [http://www.ci.manhattan-beach.ca.us/home/facts_about_manhattan_beach.html].
==Whole genome shotgun sequencing==
Residents divide the city into several distinct neighborhoods, including the [[Sand Section, Manhattan Beach, California|Sand Section]], [[Hill Section, Manhattan Beach, California|Hill Section]], [[Tree Section, Manhattan Beach, California|Tree Section]], [[El Porto, Manhattan Beach, California|El Porto]], and [[Liberty Village, Manhattan Beach, California|Liberty Village]].
Whole genome shotgun sequencing is an application of pairwise end sequencing, known colloquially as ''double-barrel shotgun sequencing''. As sequencing projects began to take on longer and more complicated projects, multiple groups began to realize that useful information could be obtained by sequencing both ends of a fragment of DNA. Although sequencing both ends of the same fragment and keeping track of the paired data was more cumbersome than sequencing a single end of two distinct fragments, the knowledge that the two sequences were oriented in opposite directions and were about the length of a fragment apart from each other was valuable in reconstructing the sequence of the original target fragment. The first published description of the use of paired ends was by Edwards et al. in 1990 as part of the sequencing of the human [[Hypoxanthine-guanine phosphoribosyltransferase]] locus, although the use of paired ends was limited to closing gaps after the application of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end sequencing strategy, assuming fragments of constant length, was by Edwards and Caskey in 1991. At the time, there was community consensus that the optimal fragment length for pairwise end sequencing would be three times the sequence read length. In 1995 Roach et al. introduced the innovation of using fragments of varying sizes, and demonstrated that a pure pairwise end-sequencing strategy would be possible on large targets. The strategy was subsequently adopted by [[The Institute for Genomic Research]] (TIGR) to sequence the genome of the bacterium ''Haemophilus influenzae'' in 1995, and then by [[Celera Genomics]] to sequence the fruit fly genome in 2000, and subsequently the human genome.
To apply the strategy, high-molecular-weight DNA is sheared into random fragments, size-selected (usually 2, 10, 50, and 150 kb), and [[clone (genetics)|clone]]d into an appropriate vector. The clones are then sequenced from both ends using the [[chain termination method]] yielding two short sequences. Each sequence is called an ''end-read'' or ''read'' and two reads from the same clone are referred to as ''mate pairs''. Since the chain termination method usually can only produce reads between 500 and 1000 bases long, in all but the smallest clones, mate pairs will rarely overlap.
== Demographics ==
As of the [[census]]{{GR|2}} of [[2000]], there are 33,852 people, 14,474 households, and 8,394 families residing in the city. The [[population density]] is 3,325.8/km² (8,606.7/mi²). There are 15,034 housing units at an average density of 1,477.0/km² (3,822.3/mi²). The racial makeup of the city is 88.99% [[White (U.S. Census)|White]], 0.61% [[African American (U.S. Census)|African American]], 0.21% [[Native American (U.S. Census)|Native American]], 6.04% [[Asian (U.S. Census)|Asian]], 0.12% [[Pacific Islander (U.S. Census)|Pacific Islander]], 1.23% from [[Race (U.S. Census)|other races]], and 2.81% from two or more races. 5.19% of the population are [[Hispanic (U.S. Census)|Hispanic]] or [[Latino (U.S. Census)|Latino]] of any race.
The original sequence is reconstructed from the reads using sequence assembly [[software]]. First, overlapping reads are collected into longer composite sequences known as ''contigs''. Contigs can be linked together into ''scaffolds'' by following connections between mate pairs. The distance between contigs can be inferred from the mate pair positions if the library size is known and has a narrow window of deviation.
There are 14,474 households out of which 28.1% have children under the age of 18 living with them, 49.8% are [[Marriage|married couples]] living together, 5.8% have a female householder with no husband present, and 42.0% are non-families. 29.3% of all households are made up of individuals and 6.5% have someone living alone who is 65 years of age or older. The average household size is 2.34 and the average family size is 2.98.
'''Coverage''' is the average number of reads representing a given [[nucleotide]] in the reconstructed sequence. It can be calculated from the length of the original genome (G), the number of reads(N), and the average read length(L) as <math>{NL \over G}</math>. For example, a hypothetical genome with 2,000 base pairs reconstructed from 8 reads with an average length of 500 nucleotides will have 2x coverage.
In the city the population is spread out with 22.3% under the age of 18, 4.1% from 18 to 24, 37.5% from 25 to 44, 25.7% from 45 to 64, and 10.4% who are 65 years of age or older. The median age is 38 years. For every 100 females there are 101.5 males. For every 100 females age 18 and over, there are 101.6 males.
Proponents of this approach argue that it is possible to sequence the whole [[genome]] at once using large arrays of sequencers, which makes the whole process much more efficient than more traditional approaches. Detractors argue that although the technique quickly sequences large regions of DNA, its ability to correctly link these regions is suspect, particularly for genomes with repeating regions. As [[sequence assembly]] programs become more sophisticated and computing power becomes cheaper, it may be possible to overcome this limitation{{Fact|date=February 2007}}.
The median income for a household in the city is $100,750, and the median income for a family is $122,686. Males have a median income of $84,256 versus $54,142 for females. The [[per capita income]] for the city is $61,136. 3.2% of the population and 2.0% of families are below the [[poverty line]]. Out of the total population, 2.3% of those under the age of 18 and 4.9% of those 65 and older are living below the poverty line.
==References==
In November 2005 Manhattan Beach had a median home price of $1,845,000 [http://www.dqnews.com/ZIPLAT.shtm]. In its Best Places to Live 2005 feature, [[Money Magazine]] ranked Manhattan Beach the 4th most expensive town in America. [http://money.cnn.com/best/bplive/topten/homes.html]
*{{cite web | title=Shotgun sequencing comes of age | work=The Scientist | url=http://www.the-scientist.com/news/20021231/06 | accessdate=December 31 | accessyear=2002}}
*{{cite web | title=Shotgun sequencing finds nanoorganisms - Probe of acid mine drainage turns up unsuspected virus-sized Archaea
| work=SpaceRef.com| url=http://www.spaceref.com/news/viewpr.rss.html?pid=21532
| accessdate=December 23 | accessyear=2006}}
*{{cite journal
== Education ==
| last = Anderson
Public education in Manhattan Beach is provided by the [[Manhattan Beach Unified School District]], which oversees 5 elementary schools, 1 middle school, and 1 high school.
| first = S
| coauthors =
| title = Shotgun DNA sequencing using cloned DNase I-generated fragments
| journal = Nucleic Acids Research
| volume = 9
| issue = 13
| pages = 3015-27
| date = 1981 }}
*{{cite journal
The district as a whole received a score of 896 on the 2005 California Academic Performance Index, making it one of California's best performing districts. Each individual school also ranks at the top of its respective category [http://www.manhattan.k12.ca.us/edsvc/api/API.SSR05.pdf]:
| last = Fleischmann
| first = RD
| coauthors = et al.
| title = Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
| journal = Science
| volume = 269
| issue = 5223
| pages = 496-512
| date = 1995 }}
*{{cite journal
{| border="1" cellpadding="5" cellspacing="0" align="left"
| last = Adams
!- |School||2005 API Score
| first = MD
|-
| coauthors = et al. | title = The genome sequence of Drosophila melanogaster
|Grand View Elementary||934
| journal = Science
|-
| volume = 287
|Meadows Avenue Elementary||940
| issue = 5461
|-
| pages = 2185-95
|Pacific Elementary||969
| date = 2000 }}
|-
|Pennekamp Elementary||952
|-
|Robinson Elementary||960
|-
|Manhattan Beach Middle||910
|-
|[[Mira Costa High School]]||846
|}
<br clear="all">
*{{cite journal
Under policy of the Manhattan Beach Unified School District, residents who live in northern Redondo Beach may not attend schools within the MBUSD.
| last = Edwards
| first = A
| coauthors = Voss, H.; Rice, P.; Civitello, A.; Stegemann, J.; Schwager, C.; Zimmerman, J.; Erfle, H.; Caskey, T.; Ansorge, W.
| title = Automated DNA sequencing of the human HPRT locus
| journal = Genomics
| volume = 6
| pages = 593-608
| date = 1990 }}
*{{cite journal
See also: [[McMartin preschool trial]]
| last = Edwards
| first = A
| coauthors = Caskey, T
| title = Closure strategies for random DNA sequencing
| journal = Methods: A Companion to Methods in Enzymology
| volume = 3
| issue = 1
| pages = 41-47
| date = 1991 }}
*{{cite journal
== Media ==
| last = Roach
In addition to the [[Los Angeles Times]], Manhattan Beach is served by local daily the [[Daily Breeze]] and local weeklies the [[Beach Reporter]] and the [[Easy Reader]]. It is also home to the filming of the [[Fox Network]] series [[The O.C.]].
| first = JC
| coauthors = Boysen, C; Wang, K; Hood, L
| title = Pairwise end sequencing: a unified approach to genomic mapping and sequencing
| journal = Genomics
| volume = 26
| pages = 345-353
| date = 1995 }}
{{NCBI-handbook}}
== Notable residents ==
*[[Brian Cook]]: Power forward for the [[Los Angeles Lakers]]
*[[Pavol Demitra]]: Forward for the [[Los Angeles Kings]]
*[[Landon Donovan]]: Professional soccer player for the [[Los Angeles Galaxy]], U.S. National Team forward
*[[Jane Elliot]]: Actress, [[General Hospital (US TV Series)|General Hospital]] and [[Days of Our Lives]]
*[[Bill Engvall]]: Comedian with the [[Blue Collar Comedy]] group
*[[Nomar Garciaparra]]: Shortstop for the [[Los Angeles Dodgers]]
*[[Devean George]]: Small forward for the [[Los Angeles Lakers]]
*[[Tony Gonzalez (football player)|Tony Gonzalez]]: Tight end for the [[Kansas City Chiefs]]
*[[Mia Hamm]]: Soccer player
*[[Jason Kendall]]: Catcher for the [[Oakland Athletics]]
*[[Christopher Knight]]: Actor, [[The Brady Bunch]], [[The Surreal Life]], and [[My Fair Brady]]
*[[Wally Kurth]]: Actor, [[General Hospital (US TV Series)|General Hospital]] and [[Days of Our Lives]]
*[[Michelle Kwan]]: Champion figure skater
*[[Mike Mignola]]: Creator of [[Hellboy]]
*[[Michael Olowokandi]]: Athlete, Professional Basketball Player
*[[Liz Phair]]: Singer/songwriter and guitarist
*[[Zeljko Rebraca]]: Backup center for the [[Los Angeles Clippers]]
*[[Brian Shaw]]: Professional basketball player
*[[Britney Spears]]: Part-time resident and singer
*[[Tiger Woods]]: Athlete, Professional Golfer
*[[Owen Wilson]]: Actor, [[Wedding Crashers]],[[Behind Enemy Lines]]
[[Category:Molecular biology]]
== External links ==
*[http://www.ci.manhattan-beach.ca.us/ Manhattan Beach official website]
<!--below is a pretty low-quality, most business-directory website IMHO. Until a Chamber of Commerce or equivalent link is added, I'm leaving on the page-->
*[http://www.downtownmanhattanbeach.com/ Downtown Manhattan Beach]
{{Mapit-US-cityscale|33.88898|-118.405357}}
{{California-south-geo-stub}}
[[ja:ショットガン・シークエンシング法]]
{{Cities of Los Angeles County, California}}
[[zh:散弹法]]
[[Category:Cities in Los Angeles County]]
[[Category:Coastal towns of California]]
[[de:Manhattan Beach]]
[[fr:Manhattan Beach]]
| 