Content deleted Content added
No edit summary |
Richard001 (talk | contribs) |
||
Line 1:
'''Shotgun sequencing''' is a method used in [[genetics]] for [[sequencing]] long [[DNA]] strands. Since the chain termination method of [[DNA sequencing]] can only be used for fairly short strands, it is necessary to divide longer sequences up and then ''assemble'' the results to give the overall sequence. In [[chromosome walking]], this division is done by progressing through the entire strand, piece by piece; shotgun sequencing uses a faster, but more complex process to assemble random pieces of the sequence.
In shotgun sequencing, DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain ''reads''. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a contiguous sequence.
For example, consider the following two rounds of shotgun reads:
Original strand : AGCATGCTGCAGTCATGCTTAGGCTA
First round of shotgun reads : AGCATGCTGCAG
TCATGCTTAGGCTA
Second round of shotgun reads : TTAGGCTA
AGCATGCTGCAGTCATGC
In this extremely simplified example, the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally aggravated by the great abundance of [[Repeated sequence (DNA)|repetitive sequence]], meaning similar short reads could come from completely different parts of the sequence.
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the [[Human Genome Project]], most of the human genome was sequenced at 12X or greater ''coverage''; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the ([[Euchromatin|euchromatic]]) human genome.
==Whole genome shotgun sequencing==
Whole genome shotgun sequencing is an application of pairwise end sequencing, known colloquially as ''double-barrel shotgun sequencing''. As sequencing projects began to take on longer and more complicated projects, multiple groups began to realize that useful information could be obtained by sequencing both ends of a fragment of DNA. Although sequencing both ends of the same fragment and keeping track of the paired data was more cumbersome than sequencing a single end of two distinct fragments, the knowledge that the two sequences were oriented in opposite directions and were about the length of a fragment apart from each other was valuable in reconstructing the sequence of the original target fragment. The first published description of the use of paired ends was by Edwards et al. in 1990 as part of the sequencing of the human [[Hypoxanthine-guanine phosphoribosyltransferase]] locus, although the use of paired ends was limited to closing gaps after the application of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end sequencing strategy, assuming fragments of constant length, was by Edwards and Caskey in 1991. At the time, there was community consensus that the optimal fragment length for pairwise end sequencing would be three times the sequence read length. In 1995 Roach et al. introduced the innovation of using fragments of varying sizes, and demonstrated that a pure pairwise end-sequencing strategy would be possible on large targets. The strategy was subsequently adopted by [[The Institute for Genomic Research]] (TIGR) to sequence the genome of the bacterium ''Haemophilus influenzae'' in 1995, and then by [[Celera Genomics]] to sequence the fruit fly genome in 2000, and subsequently the human genome.
To apply the strategy, high-molecular-weight DNA is sheared into random fragments, size-selected (usually 2, 10, 50, and 150 kb), and [[clone (genetics)|clone]]d into an appropriate vector. The clones are then sequenced from both ends using the [[chain termination method]] yielding two short sequences. Each sequence is called an ''end-read'' or ''read'' and two reads from the same clone are referred to as ''mate pairs''. Since the chain termination method usually can only produce reads between 500 and 1000 bases long, in all but the smallest clones, mate pairs will rarely overlap.
The original sequence is reconstructed from the reads using sequence assembly [[software]]. First, overlapping reads are collected into longer composite sequences known as ''contigs''. Contigs can be linked together into ''scaffolds'' by following connections between mate pairs. The distance between contigs can be inferred from the mate pair positions if the library size is known and has a narrow window of deviation.
'''Coverage''' is the average number of reads representing a given [[nucleotide]] in the reconstructed sequence. It can be calculated from the length of the original genome (G), the number of reads(N), and the average read length(L) as <math>{NL \over G}</math>. For example, a hypothetical genome with 2,000 base pairs reconstructed from 8 reads with an average length of 500 nucleotides will have 2x coverage.
Proponents of this approach argue that it is possible to sequence the whole [[genome]] at once using large arrays of sequencers, which makes the whole process much more efficient than more traditional approaches. Detractors argue that although the technique quickly sequences large regions of DNA, its ability to correctly link these regions is suspect, particularly for genomes with repeating regions. As [[sequence assembly]] programs become more sophisticated and computing power becomes cheaper, it may be possible to overcome this limitation{{Fact|date=February 2007}}.
==References==
*{{cite web | title=Shotgun sequencing comes of age | work=The Scientist | url=http://www.the-scientist.com/news/20021231/06 | accessdate=December 31 | accessyear=2002}}
*{{cite web | title=Shotgun sequencing finds nanoorganisms - Probe of acid mine drainage turns up unsuspected virus-sized Archaea
| work=SpaceRef.com| url=http://www.spaceref.com/news/viewpr.rss.html?pid=21532
| accessdate=December 23 | accessyear=2006}}
*{{cite journal
| last = Anderson
| first = S
| coauthors =
| title = Shotgun DNA sequencing using cloned DNase I-generated fragments
| journal = Nucleic Acids Research
| volume = 9
| issue = 13
| pages = 3015-27
| date = 1981 }}
*{{cite journal
| last = Fleischmann
| first = RD
| coauthors = et al.
| title = Whole-genome random sequencing and assembly of Haemophilus influenzae Rd.
| journal = Science
| volume = 269
| issue = 5223
| pages = 496-512
| date = 1995 }}
*{{cite journal
| last = Adams
| first = MD
| coauthors = et al. | title = The genome sequence of Drosophila melanogaster
| journal = Science
| volume = 287
| issue = 5461
| pages = 2185-95
| date = 2000 }}
*{{cite journal
| last = Edwards
| first = A
| coauthors = Voss, H.; Rice, P.; Civitello, A.; Stegemann, J.; Schwager, C.; Zimmerman, J.; Erfle, H.; Caskey, T.; Ansorge, W.
| title = Automated DNA sequencing of the human HPRT locus
| journal = Genomics
| volume = 6
| pages = 593-608
| date = 1990 }}
*{{cite journal
| last = Edwards
| first = A
| coauthors = Caskey, T
| title = Closure strategies for random DNA sequencing
| journal = Methods: A Companion to Methods in Enzymology
| volume = 3
| issue = 1
| pages = 41-47
| date = 1991 }}
*{{cite journal
| last = Roach
| first = JC
| coauthors = Boysen, C; Wang, K; Hood, L
| title = Pairwise end sequencing: a unified approach to genomic mapping and sequencing
| journal = Genomics
| volume = 26
| pages = 345-353
| date = 1995 }}
{{NCBI-handbook}}
[[Category:Molecular biology]]
[[ja:ショットガン・シークエンシング法]]
[[zh:散弹法]]
| |||