Base pair: Difference between revisions

Content deleted Content added
Variant of base pairing: {{main|Non-canonical base pairing}}
Citation bot (talk | contribs)
Add: date, article-number, bibcode. Removed parameters. Some additions/deletions were parameter name changes. | Use this bot. Report bugs. | Suggested by Abductive | Category:Nucleobases | #UCB_Category 30/39
 
(76 intermediate revisions by 45 users not shown)
Line 1:
{{shortShort description|Unit consisting of twoTwo nucleobases bound to each other by hydrogen bonds}}
[[File:AT DNA base-pair pairdiagram.svgjpg|thumb|250pxupright=1.4|DepictionThe ofchemical thestructure [[adenine]]–[[thymine]]of Watson–CrickDNA base pair-pairs]]
A '''base pair''' ('''bp''') is a fundamental unit of double-stranded [[nucleic acids]] consisting of two [[nucleobases]] bound to each other by [[hydrogen bond]]s. They form the building blocks of the [[DNA]] double helix and contribute to the folded structure of both DNA and [[RNA]]. Dictated by specific [[hydrogen bond]]ing patterns, "Watson–Crick" (or "Watson–Crick–Franklin") base pairs ([[guanine]]–[[cytosine]] and [[adenine]]–[[thymine]]/[[uracil]])<ref>{{cite journal |last1 vauthors = Spencer |first1=M. |title=The stereochemistry of deoxyribonucleic acid. II. Hydrogen-bonded pairs of bases |journal=Acta Crystallographica |date=10 January 1959 |volume=12 |issue=1 |pages=66–71 |doi=10.1107/S0365110X59000160 |bibcode=1959AcCry..12...66S |url=https://scripts.iucr.org/cgi-bin/paper?S0365110X59000160 |language=en |issn=0365-110X|url-access=subscription }}</ref> allow the DNA helix to maintain a regular helical structure that is subtly dependent on its [[nucleotide sequence]].<ref>{{Cite book |chapter=Sequence-Dependent Variability of B-DNA | doi=10.1007/0-387-29148-2_2 | journaltitle=DNA Conformation and Transcription |pages=18–34 |year=2005 | vauthors = Zhurkin VB, Tolstorukov MY, Xu F, Colasanti AV, Olson WK | isbn=978-0-387-25579-8 }}</ref> The [[Complementarity (molecular biology)|complementary]] nature of this based-paired structure provides a [[Redundancy (information theory)|redundant]] copy of the [[genetic information]] encoded within each strand of DNA. The regular structure and data redundancy provided by the DNA double helix make DNA well suited to the storage of genetic information, while base-pairing between DNA and incoming nucleotides provides the mechanism through which [[DNA polymerase]] replicates DNA and [[RNA polymerase]] transcribes DNA into RNA. Many DNA-binding proteins can recognize specific base-pairing patterns that identify particular regulatory regions of genes.
 
Intramolecular base pairs can occur within single-stranded nucleic acids. This is particularly important in RNA molecules (e.g., [[transfer RNA]]), where Watson–Crick base pairs (guanine–cytosine and adenine–[[adenine-uracil]]) permit the formation of short double-stranded helices, and a wide variety of non–Watson–Crick interactions (e.g., G–U or A–A) allow RNAs to fold into a vast range of specific three-dimensional [[RNA structure|structures]]. In addition, base-pairing between [[transfer RNA]] (tRNA) and [[messenger RNA]] (mRNA) forms the basis for the [[molecular recognition]] events that result in the nucleotide sequence of mRNA becoming [[Genetic code|translated]] into the amino acid sequence of [[protein]]s via the [[genetic code]].
 
The size of an individual [[gene]] or an organism's entire [[genome]] is often measured in base pairs because DNA is usually double-stranded. Hence, the number of total base pairs is equal to the number of nucleotides in one of the strands (with the exception of non-coding single-stranded regions of [[telomere]]s). The [[haploid]] [[human genome]] (23 [[chromosome]]s) is estimated to be about 3.2 billion basesbase pairs long and to contain 20,000–25,000 distinct protein-coding genes.<ref>{{cite web |last=Moran |firstvauthors =Laurence A. | name-list-style =Moran vancLA |url=http://sandwalk.blogspot.com/2011/03/how-big-is-human-genome.html |title=The total size of the human genome is very likely to be ~3,200 Mb |publisher=Sandwalk.blogspot.com |date=2011-03-24 |access-date=2012-07-16}}</ref><ref>{{cite web |url=http://www.strategicgenomics.com/Genome/index.htm |title=The finished length of the human genome is 2.86 Gb |publisher=Strategicgenomics.com |date=2006-06-12 |access-date=2012-07-16}}</ref><ref>{{cite web |url=https://www.genome.gov/genetics-glossary/Base-Pair |title=One copy of the human genome consists of approximately 3 billion base pairs of DNA |publisher=National Human Genome Research Institute |date=2024-08-24}}</ref><ref name="IHSGC2004">{{cite journal | authorvauthors = ((International Human Genome Sequencing Consortium)) | title = Finishing the euchromatic sequence of the human genome | journal = Nature | volume = 431 | issue = 7011 | pages = 931–45931–945 | date = October 2004 | pmid = 15496913 | doi = 10.1038/nature03001 | doi-access = free | bibcode = 2004Natur.431..931H | doi-access = free }}</ref> A [[kilobase]] (kb) is a unit of measurement in [[molecular biology]] equal to 1000 base pairs of DNA or RNA.<ref>{{cite journal | vauthors = Cockburn AF, Newkirk MJ, Firtel RA | title = Organization of the ribosomal RNA genes of Dictyostelium discoideum: mapping of the nontranscribed spacer regions | journal = Cell | volume = 9 | issue = 4 Pt 1 | pages = 605–13605–613 | date = December 1976 | pmid = 1034500 | doi = 10.1016/0092-8674(76)90043-X | s2cid = 31624366 }}</ref> The total number of [[DNA]] base pairs on Earth is estimated at 5.0{{e|37}} with a weight of 50 billion [[tonne]]s.<ref name="NYT-20150718-rn">{{cite news |last vauthors = Nuwer |first=RachelR | nameauthor-list-style link=Rachel vancNuwer |date=18 July 2015 |title=Counting All the DNA on Earth |url=https://www.nytimes.com/2015/07/21/science/counting-all-the-dna-on-earth.html |archive-url=https://ghostarchive.org/archive/20220101/https://www.nytimes.com/2015/07/21/science/counting-all-the-dna-on-earth.html |archive-date=2022-01-01 |url-access=limited |work=The New York Times |___location=New York |issn=0362-4331 |access-date=2015-07-18}}{{cbignore}}</ref><!--- PLOS paper cited by NYT used 'tonne' unit. ---> In comparison, the total [[Biomass (ecology)|mass]] of the [[biosphere]] has been estimated to be as much as 4&nbsp;[[tonnes#Derived units|TtC]] (trillion tons of [[carbon]]).<ref name="AGCI-2015">{{cite web |url=http://www.agci.org/classroom/biosphere/index.php |title=The Biosphere: Diversity of Life |author=<!--Staff writer(s); no by-line.--> |website=Aspen Global Change Institute |___location=Basalt, CO |access-date=2015-07-19 |archive-date=2014-11-10 |archive-url=https://web.archive.org/web/20141110164609/http://www.agci.org/classroom/biosphere/index.php |url-status=dead }}</ref><!--- Aspen Global Change Institute (US-based) defined TtC as 'trillion tons of C'. --->
 
== Notation ==
==Hydrogen bonding and stability==
This article employs the "•" character in describing any noncovalant interaction, which includes all types of base pairs, in line with IUPAC's 1970 recommendation.<ref name=iupac70>{{Cite journal | author = IUPAC-IUB Commission on Biochemical Nomenclature | doi = 10.1021/bi00822a023 | title = Abbreviations and symbols for nucleic acids, polynucleotides, and their constituents | journal = [[Biochemistry (journal)|Biochemistry]] | volume = 9 | issue = 20 | pages = 4022–4027 | year = 1970|url=https://iupac.qmul.ac.uk/misc/naabb.html }}</ref>{{rp|at=N3.4.2}}
 
According to the IUPAC, "-" is not acceptable because it implies covalent linkage and neither are ":" and "/" because they can be mistaken as ratios. Not using any symbol is also unacceptable because it can be confused with a (covalent) polymer sequence.<ref name=iupac70/>{{rp|at=N3.4.2}}
 
IUPAC makes no specific recommendation for differentiating types of noncovalant bonds. When it is necessary to differentiate, this article uses "*" for the Hogsteen pair.
 
== Hydrogen bonding and stability ==
<div class="thumb tright" style="background:#f9f9f9; border:1px solid #ccc; margin:0.5em;">
{| border="0" border="0" cellpadding="2" cellspacing="0" style="width:230px; font-size:85%; border:1px solid #ccc; margin:0.3em;"
|-
|[[File:Base pair GC.svg|282px]]
|}
{| border="0" border="0" cellpadding="2" cellspacing="0" style="width:230px; font-size:85%; border:1px solid #ccc; margin:0.3em;"
|-
|[[File:Base pair AT.svg|282px]]
|}
<div style="border: none; width:282px;"><div class="thumbcaption">Top, a '''G.CG•C''' base pair with three [[hydrogen bond]]s. Bottom, an '''A.TA•T''' base pair with two hydrogen bonds. Non-covalent hydrogen bonds between the bases are shown as dashed lines. The wiggly lines stand for the connection to the pentose sugar and point in the direction of the minor groove. </div></div></div>
 
[[Hydrogen bond]]ing is the chemical interaction that underlies the base-pairing rules described above. Appropriate geometrical correspondence of hydrogen bond donors and acceptors allows only the "right" pairs to form stably. DNA with high [[GC-content]] is more stable than DNA with low GC-content. ButCrucially, contraryhowever, to[[stacking popular(chemistry)|stacking belief,interactions]] are primarily responsible for stabilising the hydrogendouble-helical bondsstructure; doWatson-Crick base pairing's contribution to global structural stability is minimal, but its notrole stabilizein the DNAspecificity significantly;underlying stabilizationcomplementarity is, mainlyby duecontrast, toof maximal importance as this underlies the template-dependent processes of the [[stackingCentral (chemistry)dogma of molecular biology|stackingcentral interactionsdogma]] (e.g. [[DNA replication]]).<ref name="Yakovchuk2006">{{cite journal | vauthors = Yakovchuk P, Protozanova E, Frank-Kamenetskii MD | title = Base-stacking and base-pairing contributions into thermal stability of the DNA double helix | journal = Nucleic Acids Research | volume = 34 | issue = 2 | pages = 564–74564–574 | date = 2006-01-30 | pmid = 16449200 | pmc = 1360284 | doi = 10.1093/nar/gkj454 }}</ref>
 
The bigger [[nucleobase]]s, adenine and guanine, are members of a class of double-ringed chemical structures called [[purine]]s; the smaller nucleobases, cytosine and thymine (and uracil), are members of a class of single-ringed chemical structures called [[pyrimidine]]s. Purines are complementary only with pyrimidines: pyrimidine-pyrimidinepyrimidine–pyrimidine pairings are energetically unfavorable because the molecules are too far apart for hydrogen bonding to be established; purine-purinepurine–purine pairings are energetically unfavorable because the molecules are too close, leading to overlap repulsion. Purine-pyrimidinePurine–pyrimidine base-pairing of AT or GC or UA (in RNA) results in proper duplex structure. The only other purine-pyrimidinepurine–pyrimidine pairings would be AC and GT and UG (in RNA); these pairings are mismatches because the patterns of hydrogen donors and acceptors do not correspond. The GU pairing, with two hydrogen bonds, does occur fairly often in [[RNA]] (see [[wobble base pair]]).
 
Paired DNA and RNA molecules are comparatively stable at room temperature, but the two nucleotide strands will separate above a [[Dna melting|melting point]] that is determined by the length of the molecules, the extent of mispairing (if any), and the GC content. Higher GC content results in higher melting temperatures; it is, therefore, unsurprising that the genomes of [[extremophile]] organisms such as ''[[Thermus thermophilus]]'' are particularly GC-rich. On the converse, regions of a genome that need to separate frequently — for example, the promoter regions for often-[[transcription (genetics)|transcribed]] genes — are comparatively GC-poor (for example, see [[TATA box]]). GC content and melting temperature must also be taken into account when designing [[primer (molecular biology)|primers]] for [[Polymerase chain reaction|PCR]] reactions.{{citation needed|date=August 2022}}
 
=== Examples ===
The following DNA sequences illustrate pair double-stranded patterns. By convention, the top strand is written from the [[5' 5′-end]] to the [[3' 3′-end]]; thus, the bottom strand (complementary strand) is written 3'3′ to 5'5′.
: A base-paired DNA sequence:
 
:: {{code|ATCGATTGAGCTCTAGCG}}
:A base-paired DNA sequence:
:: {{code|ATCGATTGAGCTCTAGCGTAGCTAACTCGAGATCGC}}
: The corresponding RNA sequence, in which [[uracil]] is substituted for thymine in the RNA strand:
::{{code|TAGCTAACTCGAGATCGC}}
:: {{code|AUCGAUUGAGCUCUAGCG}}
 
:: {{code|UAGCUAACUCGAGAUCGC}}
:The corresponding RNA sequence, in which [[uracil]] is substituted for thymine in the RNA strand:
::{{code|AUCGAUUGAGCUCUAGCG}}
::{{code|UAGCUAACUCGAGAUCGC}}
 
==Base analogs and intercalators==
 
{{Main|Nucleic acid analogue}}
Chemical analogs of nucleotides can take the place of proper nucleotides and establish non-canonical base-pairing, leading to errors (mostly [[point mutation]]s) in [[DNA replication]] and [[Transcription (genetics)|DNA transcription]]. This is due to their [[isosteric]] chemistry. One common mutagenic base analog is [[5-bromouracil]], which resembles thymine but can base-pair to guanine in its [[enol]] form.
 
Other chemicals, known as [[DNA intercalation|DNA intercalators]], fit into the gap between adjacent bases on a single strand and induce [[frameshift mutation]]s by "masquerading" as a base, causing the DNA replication machinery to skip or insert additional nucleotides at the intercalated site. Most intercalators are large [[polyaromatic]] compounds and are known or suspected [[carcinogen]]s. Examples include [[ethidium bromide]] and [[acridine]].
 
==Unnatural base pair (UBP)==
{{See also|Artificial gene synthesis|Expanded genetic code|Nucleic acid analogue|Synthetic genomics}}
An unnatural base pair (UBP) is a designed subunit (or [[nucleobase]]) of [[DNA]] which is created in a laboratory and does not occur in nature. DNA sequences have been described which use newly created nucleobases to form a third base pair, in addition to the two base pairs found in nature, A-T ([[adenine]] – [[thymine]]) and G-C ([[guanine]] – [[cytosine]]). A few research groups have been searching for a third base pair for DNA, including teams led by [[Steven A. Benner]], [[Philippe Marliere]], [[Floyd E. Romesberg]] and [[Ichiro Hirao]].<ref name="Fikes">{{cite news|url=http://www.utsandiego.com/news/2014/may/08/tp-life-engineered-with-expanded-genetic-code/|title=Life engineered with expanded genetic code|last=Fikes|first=Bradley J.| name-list-style = vanc |date=May 8, 2014|work=San Diego Union Tribune|access-date=8 May 2014|url-status=dead |archive-url=https://web.archive.org/web/20140509001048/http://www.utsandiego.com/news/2014/may/08/tp-life-engineered-with-expanded-genetic-code/|archive-date=9 May 2014}}</ref> Some new base pairs based on alternative hydrogen bonding, hydrophobic interactions and metal coordination have been reported.<ref>{{cite journal | vauthors = Yang Z, Chen F, Alvarado JB, Benner SA | title = Amplification, mutation, and sequencing of a six-letter synthetic genetic system | journal = Journal of the American Chemical Society | volume = 133 | issue = 38 | pages = 15105–12 | date = September 2011 | pmid = 21842904 | pmc = 3427765 | doi = 10.1021/ja204910n }}</ref><ref>{{cite journal | vauthors = Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I | title = Highly specific unnatural base pair systems as a third base pair for PCR amplification | journal = Nucleic Acids Research | volume = 40 | issue = 6 | pages = 2793–806 | date = March 2012 | pmid = 22121213 | pmc = 3315302 | doi = 10.1093/nar/gkr1068 | url = }}</ref><ref name="Malyshev PNAS 20120724"/><ref>{{Cite journal|last1=Takezawa|first1=Yusuke|last2=Müller|first2=Jens|last3=Shionoya|first3=Mitsuhiko|date=2017-05-05|title=Artificial DNA Base Pairing Mediated by Diverse Metal Ions|url=http://www.journal.csj.jp/doi/10.1246/cl.160985|journal=Chemistry Letters|language=en|volume=46|issue=5|pages=622–633|doi=10.1246/cl.160985|issn=0366-7022|doi-access=free}}</ref>
 
In 1989 Steven Benner (then working at the [[ETH Zurich|Swiss Federal Institute of Technology]] in Zurich) and his team led with modified forms of cytosine and guanine into DNA molecules ''in vitro''.<ref>{{cite journal | vauthors = Switzer C, Moroney SE, Benner SA | title = Enzymatic incorporation of a new base pair into DNA and RNA | date = 1989 | journal = J. Am. Chem. Soc. | volume = 111 | issue = 21| pages = 8322–8323 | doi = 10.1021/ja00203a067 }}</ref> The nucleotides, which encoded RNA and proteins, were successfully replicated ''in vitro''. Since then, Benner's team has been trying to engineer cells that can make foreign bases from scratch, obviating the need for a feedstock.<ref name="Ewan">{{cite news| url=http://www.huffingtonpost.com/2014/05/07/living-organism-artificial-dna_n_5283095.html |title=Scientists Create First Living Organism With 'Artificial' DNA| last=Callaway| first=Ewan | name-list-style = vanc |date=May 7, 2014| work=Nature News| publisher=Huffington Post| access-date=8 May 2014}}</ref>
 
In 2002, Ichiro Hirao's group in Japan developed an unnatural base pair between 2-amino-8-(2-thienyl)purine (s) and pyridine-2-one (y) that functions in transcription and translation, for the site-specific incorporation of non-standard amino acids into proteins.<ref>{{cite journal | vauthors = Hirao I, Ohtsuki T, Fujiwara T, Mitsui T, Yokogawa T, Okuni T, Nakayama H, Takio K, Yabuki T, Kigawa T, Kodama K, Yokogawa T, Nishikawa K, Yokoyama S | title = An unnatural base pair for incorporating amino acid analogs into proteins | journal = Nature Biotechnology | volume = 20 | issue = 2 | pages = 177–82 | date = February 2002 | pmid = 11821864 | doi = 10.1038/nbt0202-177 | s2cid = 22055476 }}</ref> In 2006, they created 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa) as a third base pair for replication and transcription.<ref>{{cite journal | vauthors = Hirao I, Kimoto M, Mitsui T, Fujiwara T, Kawai R, Sato A, Harada Y, Yokoyama S | title = An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA | journal = Nature Methods | volume = 3 | issue = 9 | pages = 729–35 | date = September 2006 | pmid = 16929319 | doi = 10.1038/nmeth915 | s2cid = 6494156 }}</ref> Afterward, Ds and 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole (Px) was discovered as a high fidelity pair in PCR amplification.<ref>Kimoto, M. et al. (2009) An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules. Nucleic acids Res. 37, e14</ref><ref>{{cite journal | vauthors = Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I | title = Highly specific unnatural base pair systems as a third base pair for PCR amplification | journal = Nucleic Acids Research | volume = 40 | issue = 6 | pages = 2793–806 | date = March 2012 | pmid = 22121213 | pmc = 3315302 | doi = 10.1093/nar/gkr1068 }}</ref> In 2013, they applied the Ds-Px pair to DNA aptamer generation by ''in vitro'' selection (SELEX) and demonstrated the genetic alphabet expansion significantly augment DNA aptamer affinities to target proteins.<ref>{{cite journal | vauthors = Kimoto M, Yamashige R, Matsunaga K, Yokoyama S, Hirao I | title = Generation of high-affinity DNA aptamers using an expanded genetic alphabet | journal = Nature Biotechnology | volume = 31 | issue = 5 | pages = 453–7 | date = May 2013 | pmid = 23563318 | doi = 10.1038/nbt.2556 | s2cid = 23329867 }}</ref>
 
In 2012, a group of American scientists led by Floyd Romesberg, a chemical biologist at the [[Scripps Research Institute]] in San Diego, California, published that his team designed an unnatural base pair (UBP).<ref name="Malyshev PNAS 20120724">{{cite journal | vauthors = Malyshev DA, Dhami K, Quach HT, Lavergne T, Ordoukhanian P, Torkamani A, Romesberg FE | title = Efficient and sequence-independent replication of DNA containing a third base pair establishes a functional six-letter genetic alphabet | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 109 | issue = 30 | pages = 12005–10 | date = July 2012 | pmid = 22773812 | pmc = 3409741 | doi = 10.1073/pnas.1205176109 | bibcode = 2012PNAS..10912005M }}</ref> The two new artificial nucleotides or ''Unnatural Base Pair'' (UBP) were named [[d5SICS]] and [[dNaM]]. More technically, these artificial [[nucleotide]]s bearing hydrophobic [[nucleobase]]s, feature two fused [[Aromatic hydrocarbon|aromatic rings]] that form a (d5SICS–dNaM) complex or base pair in DNA.<ref name="Ewan"/><ref name="NATJ-20140507" /> His team designed a variety of ''in vitro'' or "test tube" templates containing the unnatural base pair and they confirmed that it was efficiently replicated with high fidelity in virtually all sequence contexts using the modern standard ''in vitro'' techniques, namely [[Polymerase chain reaction|PCR amplification of DNA]] and PCR-based applications.<ref name="Malyshev PNAS 20120724"/> Their results show that for PCR and PCR-based applications, the d5SICS–dNaM unnatural base pair is functionally equivalent to a natural base pair, and when combined with the other two natural base pairs used by all organisms, A–T and G–C, they provide a fully functional and expanded six-letter "genetic alphabet".<ref name="NATJ-20140507"/>
 
In 2014 the same team from the Scripps Research Institute reported that they synthesized a stretch of circular DNA known as a [[plasmid]] containing natural T-A and C-G base pairs along with the best-performing UBP Romesberg's laboratory had designed and inserted it into cells of the common bacterium ''[[Escherichia coli|E. coli]]'' that successfully replicated the unnatural base pairs through multiple generations.<ref name="Fikes"/> The [[transfection]] did not hamper the growth of the ''E. coli'' cells and showed no sign of losing its unnatural base pairs to its natural [[DNA repair]] mechanisms. This is the first known example of a living organism passing along an expanded genetic code to subsequent generations.<ref name="NATJ-20140507">{{cite journal | vauthors = Malyshev DA, Dhami K, Lavergne T, Chen T, Dai N, Foster JM, Corrêa IR, Romesberg FE | title = A semi-synthetic organism with an expanded genetic alphabet | journal = Nature | volume = 509 | issue = 7500 | pages = 385–8 | date = May 2014 | pmid = 24805238 | pmc = 4058825 | doi = 10.1038/nature13314 | bibcode = 2014Natur.509..385M }}</ref><ref name="Sample">{{cite news| url=https://www.theguardian.com/world/2014/may/07/living-organism-pass-down-artificial-dna-us-scientists| title=First life forms to pass on artificial DNA engineered by US scientists| last=Sample|first=Ian| name-list-style = vanc |date=May 7, 2014|work=The Guardian|access-date=8 May 2014}}</ref> Romesberg said he and his colleagues created 300 variants to refine the design of nucleotides that would be stable enough and would be replicated as easily as the natural ones when the cells divide. This was in part achieved by the addition of a supportive [[Algae|algal gene]] that expresses a [[Nucleoside triphosphate|nucleotide triphosphate]] transporter which efficiently imports the triphosphates of both d5SICSTP and dNaMTP into ''E. coli'' bacteria.<ref name="NATJ-20140507"/> Then, the natural bacterial replication pathways use them to accurately replicate a [[plasmid]] containing d5SICS–dNaM. Other researchers were surprised that the bacteria replicated these human-made DNA subunits.<ref name = "fox" />
 
The successful incorporation of a third base pair is a significant breakthrough toward the goal of greatly expanding the number of [[amino acid]]s which can be encoded by DNA, from the existing 20 amino acids to a theoretically possible 172, thereby expanding the potential for living organisms to produce novel [[protein]]s.<ref name="Fikes"/> The artificial strings of DNA do not encode for anything yet, but scientists speculate they could be designed to manufacture new proteins which could have industrial or pharmaceutical uses.<ref name="Pollack">{{cite news| url=https://www.nytimes.com/2014/05/08/business/researchers-report-breakthrough-in-creating-artificial-genetic-code.html?hpw&rref=business&_r=0| title=Scientists Add Letters to DNA's Alphabet, Raising Hope and Fear |last=Pollack| first=Andrew| name-list-style = vanc | date=May 7, 2014| work=New York Times| access-date=8 May 2014}}</ref> Experts said the synthetic DNA incorporating the unnatural base pair raises the possibility of life forms based on a different DNA code.<ref name = "fox">{{cite news| url=http://www.foxnews.com/health/2014/05/08/scientists-create-organism-using-artificial-dna/| title=Scientists create first living organism containing artificial DNA| date=May 8, 2014| work=The Wall Street Journal |publisher=Fox News| access-date=8 May 2014}}</ref><ref name = "Pollack" />
 
== Non-canonical base pairing ==
Line 64 ⟶ 48:
|width1=75
|image2=Hoogsteen_Watson_Crick_pairing-en.svg
|caption2=Comparison of Hoogsteen to Watson-CrickWatson–Crick base pairs.<ref name="Nikolova2">{{cite journal |author1=Evgenia N.vauthors Nikolova|author2=Eunae Nikolova EN, Kim|author3=Abigail A.E, Wise|author4=Patrick J.AA, O'Brien|author5=Ioan PJ, Andricioaei|author6=Hashim M.I, Al-Hashimi HM |year=2011| title = Transient Hoogsteen base pairs in canonical duplex DNA | journal = Nature | volume = 470 | issue = 7335 | pages = 498–502 |bibcode date =2011Natur.470..498N February 2011 | pmid = 21270796 | pmc = 3074620 | doi = 10.1038/nature09775 |pmc bibcode =3074620|pmid=21270796 2011Natur.470..498N }}</ref>
|width2=285
}}
In addition to the canonical Watson–Crick pairing (A•T/U G•C), some conditions can also favour base-pairing with alternative base orientation, and number and geometry of hydrogen bonds. These pairings are accompanied by alterations to the local backbone shape.{{citation needed|date=August 2022}}
 
The most common of these is the [[wobble base pair]]ing that occurs between [[tRNA]]s and [[mRNA]]s at the third base position of many [[codon]]s during [[Transcription (biology)|transcription]]<ref>{{Citecite journal |last vauthors = Murphy|first=Frank V|last2=FV, Ramakrishnan|first2= V |date=2004-11-21| title = Structure of a purine-purine wobble base pair in the decoding center of the ribosome |url=http://dx.doi.org/10.1038/nsmb866| journal = Nature Structural & Molecular Biology | volume = 11 | issue = 12 | pages = 1251–1252 | date = December 2004 | pmid = 15558050 | doi = 10.1038/nsmb866 |issn s2cid =1545-9993 27022506 }}</ref> and during the charging of tRNAs by some [[Aminoacyl tRNA synthetase|tRNA synthetases]].<ref>{{Citecite journal |last vauthors = Vargas-Rodriguez|first=Oscar|last2= O, Musier-Forsyth|first2=Karin|date=June 2014K | title =Wobble Structural biology: wobble puts RNA on target |url=https://www.nature.com/articles/nature13502| journal = Nature |language=en| volume = 510 | issue = 7506 | pages = 480–481 | date = June 2014 | pmid = 24919145 | doi = 10.1038/nature13502 |issn bibcode =1476-4687 2014Natur.510..480V | s2cid = 205239383 }}</ref> They have also been observed in the secondary structures of some RNA sequences.<ref>{{Citecite journal |last vauthors = Garg|first=Ankur|last2= A, Heinemann U |first2=Udo|date=2017-11-09| title = A novel form of RNA double helix based on G·U and C·A<sup>+</sup> wobble base pairing |url=http://dx.doi.org/10.1261/rna.064048.117| journal = RNA | volume = 24 | issue = 2 | pages = 209–218 | date = February 2018 | pmid = 29122970 | pmc = 5769748 | doi = 10.1261/rna.064048.117|issn=1355-8382 }}</ref>
 
Additionally, [[Hoogsteen base pair]]ing (typically written as A•UA*U/T and G•CG*C) can existhappen when a different "face" of a purine base is used for pairing. This happens in some DNA sequences (e.g. CA and TA dinucleotides) in dynamic equilibrium with standard Watson–Crick pairing.<ref name="Nikolova2" /> They have also been observed in some protein–DNA complexes.<ref name="Aishima">{{cite journal |author1=Evgenia N.vauthors Nikolova|author2=Eunae Kim|author3=AbigailAishima A.J, Wise|author4=PatrickGitti J.RK, O'Brien|author5=IoanNoah Andricioaei|author6=HashimJE, M.Gan HH, Schlick T, Wolberger C Al-Hashimi|year=2011| title =Transient A Hoogsteen base pairspair embedded in canonical duplexundistorted B-DNA | journal =Nature Nucleic Acids Research | volume =470 30 | issue =7335 23 | pages =498–502 5244–5252 |bibcode date =2011Natur.470..498N December 2002 |doi pmid =10.1038/nature09775 12466549 | pmc =3074620 137974 |pmid doi =21270796 10.1093/nar/gkf661 }}</ref> TheyThere haveis also beena observedkind of reverse Hoogsteen base pair in some[[tRNA]] protein–DNAwhere complexesboth a purine and a pyrimidine uses a different "face".<ref name="Aishimapmid12853610">{{cite journal |author=Jun Aishima,vauthors Rossitza= K.Zagryadskaya GittiEI, JoyceDoyon E. NoahFR, HinSteinberg HarkSV Gan,| [[Tamartitle Schlick]],= CynthiaImportance Wolberger|year=2002|title=Aof the reverse Hoogsteen base pair embedded54-58 infor undistortedtRNA function B‐DNA| journal = Nucleic Acids Res | volume =30 31 | issue =23 14 | pages =5244–5252 3946–53 | date = July 2003 | pmid = 12853610 | pmc = 165963 | doi = 10.1093/nar/gkf661gkg448 }}</ref><ref>{{cite web |pmctitle=137974Hoogsteen and reverse Hoogsteen base pairs |pmidwebsite=12466549X3DNA-DSSR: a resource for structural bioinformatics of nucleic acids|url=https://x3dna.org/highlights/hoogsteen-and-reverse-hoogsteen-base-pairs }}</ref>
 
In addition to these alternative base pairings, a wide range of base-base hydrogen bonding is observed in RNA secondary and tertiary structure.<ref name=":0">{{Citecite journal |last vauthors = Leontis|first=Neocles B|last2=NB, Westhof E |first2=Eric|date=2003| title = Analysis of RNA motifs |url=https://linkinghub.elsevier.com/retrieve/pii/S0959440X03000769| journal = Current Opinion in Structural Biology |language=en| volume = 13 | issue = 3 | pages = 300–308 | date = June 2003 | pmid = 12831880 | doi = 10.1016/S0959-440X(03)00076-9 }}</ref> These bonds are often necessary for the precise, complex shape of an RNA, as well as its binding to interaction partners.<ref name=":0" />
 
== Base pairs and mutation ==
==Length measurements==<!-- This section is linked from [[KB]] -->
 
=== Mismatch repair ===
 
Mismatched base pairs can be generated by errors of [[DNA replication]] and as intermediates during [[homologous recombination]]. The process of mismatch repair ordinarily must recognize and correctly repair a small number of base mispairs within a long sequence of normal DNA base pairs. To repair mismatches formed during DNA replication, several distinctive repair processes have evolved to distinguish between the template strand and the newly formed strand so that only the newly inserted incorrect nucleotide is removed (in order to avoid generating a mutation).<ref>{{cite journal | vauthors = Putnam CD | title = Strand discrimination in DNA mismatch repair | journal = DNA Repair | volume = 105 | article-number = 103161 | date = September 2021 | pmid = 34171627 | pmc = 8785607 | doi = 10.1016/j.dnarep.2021.103161 }}</ref> The proteins employed in mismatch repair during DNA replication, and the clinical significance of defects in this process are described in the article [[DNA mismatch repair]]. The process of mispair correction during recombination is described in the article [[gene conversion]].
 
=== Base analogs and intercalators ===
 
{{Main|Nucleic acid analogue}}
Chemical analogs of nucleotides can take the place of proper nucleotides and establish non-canonical base-pairing, leading to errors (mostly [[point mutation]]s) in [[DNA replication]] and [[Transcription (genetics)|DNA transcription]]. This is due to their [[isosteric]] chemistry. One common mutagenic base analog is [[5-bromouracil]], which resembles thymine but can base-pair to guanine in its [[enol]] form.<ref>{{cite journal | vauthors = Trautner TA, Swartz MN, Kornberg A | title = Enzymatic synthesis of deoxyribonucleic acid. X. Influence of bromouracil substitutions on replication | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 48 | issue = 3 | pages = 449–455 | date = March 1962 | pmid = 13922323 | pmc = 220799 | doi = 10.1073/pnas.48.3.449 | bibcode = 1962PNAS...48..449T | name-list-style = vanc | doi-access = free }}</ref>
 
Other chemicals, known as [[DNA intercalation|DNA intercalators]], fit into the gap between adjacent bases on a single strand and induce [[frameshift mutation]]s by "masquerading" as a base, causing the DNA replication machinery to skip or insert additional nucleotides at the intercalated site. Most intercalators are large [[polyaromatic]] compounds and are known or suspected [[carcinogen]]s. Examples include [[ethidium bromide]] and [[acridine]].<ref>{{Cite book | vauthors = Krebs JE, Goldstein ES, Kilpatrick ST, Lewin B |title=Lewin's genes XII |publisher=Jones & Bartlett Learning |year=2018 |isbn=978-1-284-10449-3 |edition=12th |___location=Burlington, Mass |page=12 |chapter=Genes are DNA and Encode RNAs and Polypeptides |quote=Each mutagenic event in the presence of an acridine results in the addition or removal of a single base pair.}}</ref>{{citation needed|date=August 2022}}
 
== As a unit of length ==
==Length measurements==<!-- This section is linked from [[KB]] -->
{{anchor|Length measurements}}
[[File:Human karyotype with bands and sub-bands.png|thumb|Schematic [[karyotype|karyogram]] of a human. The blue scale to the left of each nuclear chromosome pair (as well as the [[human mitochondrial genetics|mitochondrial genome]] at bottom left) shows its length in terms of mega–base-pairs.{{br}}{{further|Karyotype}}]]
The following abbreviations are commonly used to describe the length of a D/R[[DNA|NA molecule]]:
* bp = base pair(s)—onepair—one bp corresponds to approximately 3.4 &nbsp;[[Angstrom|Å]] (340 &nbsp;[[picometre|pm]])<ref>{{cite book| vauthors = Alberts B, Johnson A, Lewis J, Morgan D, Raff M, Roberts K, Walter P |title=Molecular Biology of the Cell|date=December 2014|publisher=Garland Science, Taylor & Francis Group|___location=New York/Abingdon|isbn=978-0-8153-4432-2|page=177|edition=6th|ref=alberts_mboc}}</ref> of length along the strand, and to roughly 618 or 643 [[AtomicDalton mass units(unit)|daltonsdalton]]s for DNA and RNA respectively.
* kb (= kbp) = kilo base pairskilo–base-pair = 1,000 bp
* Mb (= Mbp) = mega base pairsmega–base-pair = 1,000,000 bp
* Gb (= gigaGbp) base= pairsgiga–base-pair = 1,000,000,000 bp.
 
For single-stranded DNA/RNA, units of [[nucleotide]]s are used—abbreviated nt (or knt, Mnt, Gnt)—as they are not paired.
To distinguish between units of [[computer storage]] and bases, kbp, Mbp, Gbp, etc. may be used for base pairs.
 
The [[centimorgan]] is also often used to imply distance along a chromosome, but the number of base pairs it corresponds to varies widely depending on the patterns of [[chromosomal crossover]]. In the human genome, the centimorgan is about 1 million base pairs.<ref>{{cite web |url=http://rarediseases.info.nih.gov/Glossary.aspx?acronym=False#C |title=NIH ORDR – Glossary – C |publisher=Rarediseases.info.nih.gov |access-date=2012-07-16 |archive-date=2012-07-17 |archive-url=https://web.archive.org/web/20120717121400/http://rarediseases.info.nih.gov/Glossary.aspx?acronym=False#C |url-status=dead }}</ref><ref>{{cite book |vauthors=Scott MP, Matsudaira P, Lodish H, Darnell J, Zipursky L, Kaiser CA, Berk A, Krieger M |title=Molecular Cell Biology |edition=Fifth |publisher=W. H. Freeman |___location=San Francisco |date=2004 |page=[https://archive.org/details/molecularcellbio00harv/page/396 396] |isbn=978-0-7167-4366-8 |quote=...in humans 1 centimorgan on average represents a distance of about 7.5x10<sup>5</sup> base pairs. |url-access=registration |url=https://archive.org/details/molecularcellbio00harv/page/396 }}</ref>
 
== Unnatural base pair (UBP) ==
{{See also|Artificial gene synthesis|Expanded genetic code|Nucleic acid analogue|Synthetic genomics}}
An unnatural base pair (UBP) is a designed subunit (or [[nucleobase]]) of [[DNA]] which is created in a laboratory and does not occur in nature. DNA sequences have been described which use newly created nucleobases to form a third base pair, in addition to the two base pairs found in nature, A-TA•T ([[adenine]] – [[thymine]]) and G-CG•C ([[guanine]] – [[cytosine]]). A few research groups have been searching for a third base pair for DNA, including teams led by [[Steven A. Benner]], [[Philippe Marliere]], [[Floyd E. Romesberg]] and [[Ichiro Hirao]].<ref name="Fikes">{{cite news|url=http://www.utsandiego.com/news/2014/may/08/tp-life-engineered-with-expanded-genetic-code/|title=Life engineered with expanded genetic code|last=Fikes|first=Bradley J.|vauthors name-list-style= =Fikes vancBJ |date=May 8, 2014|work=San Diego Union Tribune|access-date=8 May 2014|url-status=dead |archive-url=https://web.archive.org/web/20140509001048/http://www.utsandiego.com/news/2014/may/08/tp-life-engineered-with-expanded-genetic-code/|archive-date=9 May 2014}}</ref> Some new base pairs based on alternative hydrogen bonding, hydrophobic interactions and metal coordination have been reported.<ref>{{cite journal | vauthors = Yang Z, Chen F, Alvarado JB, Benner SA | title = Amplification, mutation, and sequencing of a six-letter synthetic genetic system | journal = Journal of the American Chemical Society | volume = 133 | issue = 38 | pages = 15105–1215105–15112 | date = September 2011 | pmid = 21842904 | pmc = 3427765 | doi = 10.1021/ja204910n | bibcode = 2011JAChS.13315105Y }}</ref><ref name="Highly">{{cite journal | vauthors = Yamashige R, Kimoto M, Takezawa Y, Sato A, Mitsui T, Yokoyama S, Hirao I | title = Highly specific unnatural base pair systems as a third base pair for PCR amplification | journal = Nucleic Acids Research | volume = 40 | issue = 6 | pages = 2793–8062793–2806 | date = March 2012 | pmid = 22121213 | pmc = 3315302 | doi = 10.1093/nar/gkr1068 | url = }}</ref><ref name="Malyshev PNAS 20120724"/><ref>{{Cite journal|last1 vauthors = Takezawa|first1=Yusuke|last2= Y, Müller|first2=Jens|last3= J, Shionoya|first3=Mitsuhiko M |date=2017-05-05|title=Artificial DNA Base Pairing Mediated by Diverse Metal Ions|url=http://www.journal.csj.jp/doi/10.1246/cl.160985|journal=Chemistry Letters|language=en|volume=46|issue=5|pages=622–633|doi=10.1246/cl.160985|issn=0366-7022|doi-access=free}}</ref>
 
In 1989 Steven Benner (then working at the [[ETH Zurich|Swiss Federal Institute of Technology]] in Zurich) and his team led with modified forms of cytosine and guanine into DNA molecules ''in vitro''.<ref>{{cite journal | vauthors = Switzer C, Moroney SE, Benner SA | title = Enzymatic incorporation of a new base pair into DNA and RNA | date = 1989 | journal = J. Am. Chem. Soc. | volume = 111 | issue = 21| pages = 8322–8323 | doi = 10.1021/ja00203a067 | bibcode = 1989JAChS.111.8322S }}</ref> The nucleotides, which encoded RNA and proteins, were successfully replicated ''in vitro''. Since then, Benner's team has been trying to engineer cells that can make foreign bases from scratch, obviating the need for a feedstock.<ref name="Ewan">{{cite news| url=http://www.huffingtonpost.com/2014/05/07/living-organism-artificial-dna_n_5283095.html |title=Scientists Create First Living Organism With 'Artificial' DNA| last=Callaway|vauthors first=Ewan | name-list-style =Callaway vancE |date=May 7, 2014| work=Nature News| publisher=Huffington Post| access-date=8 May 2014}}</ref>
 
In 2002, Ichiro Hirao's group in Japan developed an unnatural base pair between 2-amino-8-(2-thienyl)purine (s) and pyridine-2-one (y) that functions in transcription and translation, for the site-specific incorporation of non-standard amino acids into proteins.<ref>{{cite journal | vauthors = Hirao I, Ohtsuki T, Fujiwara T, Mitsui T, Yokogawa T, Okuni T, Nakayama H, Takio K, Yabuki T, Kigawa T, Kodama K, Yokogawa T, Nishikawa K, Yokoyama S | display-authors = 6 | title = An unnatural base pair for incorporating amino acid analogs into proteins | journal = Nature Biotechnology | volume = 20 | issue = 2 | pages = 177–82177–182 | date = February 2002 | pmid = 11821864 | doi = 10.1038/nbt0202-177 | s2cid = 22055476 }}</ref> In 2006, they created 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and pyrrole-2-carbaldehyde (Pa) as a third base pair for replication and transcription.<ref>{{cite journal | vauthors = Hirao I, Kimoto M, Mitsui T, Fujiwara T, Kawai R, Sato A, Harada Y, Yokoyama S | display-authors = 6 | title = An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA | journal = Nature Methods | volume = 3 | issue = 9 | pages = 729–35729–735 | date = September 2006 | pmid = 16929319 | doi = 10.1038/nmeth915 | s2cid = 6494156 }}</ref> Afterward, Ds and 4-[3-(6-aminohexanamido)-1-propynyl]-2-nitropyrrole (Px) was discovered as a high fidelity pair in PCR amplification.<ref>Kimoto, M. et al. (2009) An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules. Nucleic acids Res. 37, e14</ref><ref>{{cite journal | vauthors = Yamashige R, Kimoto M, TakezawaKawai Y, Sato AR, Mitsui T, Yokoyama S, Hirao I | title = Highly specificAn unnatural base pair systemssystem asfor aefficient thirdPCR baseamplification pairand forfunctionalization PCRof amplificationDNA molecules | journal = Nucleic Acids Research | volume = 4037 | issue = 62 | pages = 2793–806e14 | date = MarchFebruary 20122009 | pmid = 2212121319073696 | pmc = 33153022632903 | doi = 10.1093/nar/gkr1068gkn956 | name-list-style = vanc }}</ref><ref name="Highly"/> In 2013, they applied the Ds-Px pair to DNA aptamer generation by ''in vitro'' selection (SELEX) and demonstrated the genetic alphabet expansion significantly augment DNA aptamer affinities to target proteins.<ref>{{cite journal | vauthors = Kimoto M, Yamashige R, Matsunaga K, Yokoyama S, Hirao I | title = Generation of high-affinity DNA aptamers using an expanded genetic alphabet | journal = Nature Biotechnology | volume = 31 | issue = 5 | pages = 453–7453–457 | date = May 2013 | pmid = 23563318 | doi = 10.1038/nbt.2556 | s2cid = 23329867 }}</ref>
 
In 2012, a group of American scientists led by Floyd Romesberg, a chemical biologist at the [[Scripps Research Institute]] in San Diego, California, published that his team designed an unnatural base pair (UBP).<ref name="Malyshev PNAS 20120724">{{cite journal | vauthors = Malyshev DA, Dhami K, Quach HT, Lavergne T, Ordoukhanian P, Torkamani A, Romesberg FE | title = Efficient and sequence-independent replication of DNA containing a third base pair establishes a functional six-letter genetic alphabet | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 109 | issue = 30 | pages = 12005–1012005–12010 | date = July 2012 | pmid = 22773812 | pmc = 3409741 | doi = 10.1073/pnas.1205176109 | doi-access = free | bibcode = 2012PNAS..10912005M }}</ref> The two new artificial nucleotides or ''Unnatural Base Pair'' (UBP) were named [[d5SICS]] and [[dNaM]]. More technically, these artificial [[nucleotide]]s bearing hydrophobic [[nucleobase]]s, feature two fused [[Aromatic hydrocarbon|aromatic rings]] that form a (d5SICS–dNaM) complex or base pair in DNA.<ref name="Ewan"/><ref name="NATJ-20140507" /> His team designed a variety of ''in vitro'' or "test tube" templates containing the unnatural base pair and they confirmed that it was efficiently replicated with high fidelity in virtually all sequence contexts using the modern standard ''in vitro'' techniques, namely [[Polymerase chain reaction|PCR amplification of DNA]] and PCR-based applications.<ref name="Malyshev PNAS 20120724"/> Their results show that for PCR and PCR-based applications, the d5SICS–dNaM unnatural base pair is functionally equivalent to a natural base pair, and when combined with the other two natural base pairs used by all organisms, A–T and G–C, they provide a fully functional and expanded six-letter "genetic alphabet".<ref name="NATJ-20140507"/>
 
In 2014 the same team from the Scripps Research Institute reported that they synthesized a stretch of circular DNA known as a [[plasmid]] containing natural T-A and C-G base pairs along with the best-performing UBP Romesberg's laboratory had designed and inserted it into cells of the common bacterium ''[[Escherichia coli|E. coli]]'' that successfully replicated the unnatural base pairs through multiple generations.<ref name="Fikes"/> The [[transfection]] did not hamper the growth of the ''E. coli'' cells and showed no sign of losing its unnatural base pairs to its natural [[DNA repair]] mechanisms. This is the first known example of a living organism passing along an expanded genetic code to subsequent generations.<ref name="NATJ-20140507">{{cite journal | vauthors = Malyshev DA, Dhami K, Lavergne T, Chen T, Dai N, Foster JM, Corrêa IR, Romesberg FE | display-authors = 6 | title = A semi-synthetic organism with an expanded genetic alphabet | journal = Nature | volume = 509 | issue = 7500 | pages = 385–8385–388 | date = May 2014 | pmid = 24805238 | pmc = 4058825 | doi = 10.1038/nature13314 | bibcode = 2014Natur.509..385M }}</ref><ref name="Sample">{{cite news| url=https://www.theguardian.com/world/2014/may/07/living-organism-pass-down-artificial-dna-us-scientists| title=First life forms to pass on artificial DNA engineered by US scientists| lastvauthors = Sample|first=Ian| name-list-style = vancI |date=May 7, 2014|work=The Guardian|access-date=8 May 2014}}</ref> Romesberg said he and his colleagues created 300 variants to refine the design of nucleotides that would be stable enough and would be replicated as easily as the natural ones when the cells divide. This was in part achieved by the addition of a supportive [[Algae|algal gene]] that expresses a [[Nucleoside triphosphate|nucleotide triphosphate]] transporter which efficiently imports the triphosphates of both d5SICSTP and dNaMTP into ''E. coli'' bacteria.<ref name="NATJ-20140507"/> Then, the natural bacterial replication pathways use them to accurately replicate a [[plasmid]] containing d5SICS–dNaM. Other researchers were surprised that the bacteria replicated these human-made DNA subunits.<ref name = "fox" />
 
The successful incorporation of a third base pair is a significant breakthrough toward the goal of greatly expanding the number of [[amino acid]]s which can be encoded by DNA, from the existing 20 amino acids to a theoretically possible 172, thereby expanding the potential for living organisms to produce novel [[protein]]s.<ref name="Fikes"/> The artificial strings of DNA do not encode for anything yet, but scientists speculate they could be designed to manufacture new proteins which could have industrial or pharmaceutical uses.<ref name="Pollack">{{cite news| url=https://www.nytimes.com/2014/05/08/business/researchers-report-breakthrough-in-creating-artificial-genetic-code.html?hpw&rref=business&_r=0| title=Scientists Add Letters to DNA's Alphabet, Raising Hope and Fear |last=Pollack| firstvauthors =Andrew| name-list-style =Pollack vancA | date=May 7, 2014| work=New York Times| access-date=8 May 2014}}</ref> Experts said the synthetic DNA incorporating the unnatural base pair raises the possibility of life forms based on a different DNA code.<ref name = "fox">{{cite news| url=httphttps://www.foxnews.com/health/2014/05/08/scientists-create-first-living-organism-usingcontaining-artificial-dna/| title=Scientists create first living organism containing artificial DNA| date=May 8, 2014| work=The Wall Street Journal |publisher=Fox News| access-date=8 May 2014}}</ref><ref name = "Pollack" />
 
== Data sources for base pair strengths ==
{{main|Nucleic acid thermodynamics}}
The following sources have information on the free energy (thermodynamic measures of strength) of base pairs:
* Vendeix et al. 2009, Table 1. Obtained by molecular simulation of RNA including canonical and modified bases. Free energy for 300 K.<ref>{{cite journal |last1=Vendeix |first1=FA |last2=Munoz |first2=AM |last3=Agris |first3=PF |title=Free energy calculation of modified base-pair formation in explicit solvent: A predictive model. |journal=RNA |date=December 2009 |volume=15 |issue=12 |pages=2278–87 |doi=10.1261/rna.1734309 |pmid=19861423|pmc=2779691 }}</ref>
 
However, simply knowing what the minimal-energy hydrogen-bonded state between two [[nucleobase]]s is not enough. The stability of a nucleic acid molecule also comes from [[base stacking]], the stengths of which can vary with modified bases with respect to the original version. The optimal hydrogen-bonded state for two bases can also turn out to require an unnatural amount of bending of the nucleic acid backbone. All of these contribute to the "effective" strength of a base pair in the context of [[nucleic acid secondary structure]], which is why predicting such structures need "nearest neighbor" models that describe base pairs in terms of free energy (at 37&nbsp;°C) and enthalpy (for rescaling to different temperatures) of:<ref name="nndb">{{cite web |title=Nearest Neighbor Database |date=4 May 2024 |url=https://rna.urmc.rochester.edu/NNDB/}}</ref>
* helix fragments such as AA•UU and GGUC•CUGG (the sequence on the left of the colon is in usual 5'-to-3' direction, but the one on the right is written in reversed 3'-to-5' direction)
* terminal mismatches (non-pairs at the end of helices, e.g. CA•GA).
 
A list of "nearest neighbor" models can be found at {{section link|Nucleic acid structure prediction|Thermodynamic models}}.
 
== See also ==
Line 93 ⟶ 118:
 
== References ==
{{Reflistreflist|30em}}
 
== Further reading ==
Line 99 ⟶ 124:
* {{cite book | vauthors = Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R |date=2004 |title=Molecular Biology of the Gene |edition=5th |publisher=Pearson Benjamin Cummings: CSHL Press}} (See esp. ch. 6 and 9)
* {{cite book | veditors = Sigel A, Sigel H, Sigel RK |title=Interplay between Metal Ions and Nucleic Acids|series=Metal Ions in Life Sciences |volume=10 |date=2012 |publisher=Springer |doi=10.1007/978-94-007-2172-2 |isbn=978-9-4007-2171-5|s2cid=92951134}}
* {{cite book | vauthors = Clever GH, Shionoya M |chapter=Alternative DNA Base Pairing through Metal Coordination |doi=10.1007/978-94-007-2172-2_10 |pmid=22210343 |pages=269–294 |chapter=Chapter 10. Alternative DNA Base-Pairing through Metal Coordination |title=Interplay between Metal Ions and Nucleic Acids |volume=10 |date=2012 |series=Metal Ions in Life Sciences |isbn=978-94-007-2171-5 }}
* {{cite book | vauthors = Megger DA, Megger N, Mueller J |doi=10.1007/978-94-007-2172-2_11 |pmid=22210344 |pages=295–317 |chapter=Chapter 11. Metal-Mediated Base Pairs in Nucleic Acids with Purine- and Pyrimidine-Derived NeucleosidesNucleosides |doi=10.1007/978-94-007-2172-2_11 |pmid=22210344 |pages=295–317 |title=Interplay between Metal Ions and Nucleic Acids |volume=10 |date=2012 |series=Metal Ions in Life Sciences |isbn=978-94-007-2171-5 }}
{{refend}}