The Blepharisma nuclear code (translation table 15) is a genetic code found in the nuclei of Blepharisma.[1]
Code
AAs = FFLLSSSSYY*QCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
DNA codons | RNA codons | This code (15) | Standard code (1) | |
---|---|---|---|---|
TAG | UAG | Gln (Q) | STOP = Ter (*) |
Systematic range and comments
Ciliata: Blepharisma[2]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public ___domain. [3]
- ^ Andrzej Elzanowski; Jim Ostell (26 September 1996). "The Genetic Codes". National Center for Biotechnology Information. Archived from the original on 14 March 2016. Retrieved 20 January 2017.
{{cite web}}
: Unknown parameter|deadurl=
ignored (|url-status=
suggested) (help) - ^ A Liang, K Heckman (1993). "Blepharisma uses UAA as a termination codon". Naturwissenschaften. 80: 225–226. doi:10.1007/bf01175738.
{{cite journal}}
: Unknown parameter|last-author-amp=
ignored (|name-list-style=
suggested) (help) - ^ Elzanowski, Andrzej; Ostell, Jim; Leipe, Detlef; Soussov, Vladimir. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 3 July 2016.
{{cite web}}
: Unknown parameter|name-list-format=
ignored (|name-list-style=
suggested) (help)